Final DNA Finger Printing

Aneela Shaheen

FINAL DNA FINGER PRINTING

What is a DNA fingerprint?

DNA fingerprinting is a method used to identify an individual from a sample of DNA by looking at specific patterns in their DNA.

 Historical   Background ground

Almost every cell in our body contains our DNA, on average, about 99.9 per cent of the DNA between two humans is the same. The remaining percentage makes us unique (unless you are an identical twin.) These differences can be used and compares to help differentiate you from someone else.  

  • Mini-satellites are short repetitive sequences (10-60 base pairs long) of  DNA that show great differences , from one person to the next and also then  other parts of the genome. This variation is exhibited in the number of repeated units or ‘stutters’ in the mini-satellite sequence. In 1980 first mini-satellite was discovered. 
  • DNA fingerprinting was invented in 1984 by Professor Sir Alec Jeffreys after he realize you could detect variations in human DNA, in the form of these mini-satellites.
  • DNA fingerprinting is a technique that detects lots of mini-satellites in the genome to produce a pattern specific to an individual.

RFLP analysis (Restriction fragment length polymorphism)

 It is used for the analysis of unique patterns in DNA fragments in order to genetically differentiate between organisms  these patterns depends on Variable Number of Tandem Repeats (VNTRs).

Genetic polymorphism is defined as the inherited genetic variation among individuals in over 1% of normal population. The RFLP technique explain these differences in DNA sequences to recognize and study both intra-species and interspecies variation.

Principle

Restriction endonucleases is an enzymes that cut lengthy DNA into short pieces. Each restriction endonuclease targets different nucleotide sequences in a DNA, strand and therefore cuts at different sites.

The distance between the cleavage sites of a certain restriction endonuclease differs between individuals. Hence, the length of the DNA fragments that produced by a restriction endonuclease will differ across both individual organisms and species

Procedure

1st step

Extraction

                  

  • To begin with, DNA is extracted from blood & saliva or other samples.
  • The purified DNA is digested by using restriction endonucleases.
  • The recognition sites of the enzymes consist of generally 4 to 6 base pairs in length. The shorter the sequence recognized the greater the number of fragments produced from digestion.

When there is a short sequence of GAGC that occurs repeatedly in a sample of DNA. The restriction endonuclease that recognizes the GAGC sequence, cuts the DNA at every repetition of the GAGC pattern.

  • If one sample repeats the GAGC sequence 4 times, whilst another sample repeats it 2 times, the length of the fragments generated by the enzyme for the two samples will be different from each other.

2nd step

Gel Electrophoresis

     

  • The DNA fragments produced during DNA fragmentation are analyzed using gel electrophoresis.
  • The DNA fragment are negatively charged and can be easily separated by electrophoresis, which separates molecules on the basis of on their size and charge. The fragmented DNA samples are placed in the chamber that containing the electrophoretic gel and two electrodes.
  • Electric field applied: When current is applied, the fragments migrate towards the positive electrode. Smaller fragments move faster through the gel as compared the larger and thus the DNA samples are separated into distinct bands on the gel.

Transfer on to the nylon membrane.

  • DNA transfer to the nylon membrane to unzip the DNA

Radioactive probe applied on to the DNA: In molecular biology, a hybridization probe is a fragment of DNA of variable length (usually 100–1000 bases long) which can be radioactively labeled. It can then be used in DNA samples to detect the presence of nucleotide sequences (the DNA target) that are complementary to the sequence in the probe.                                   

Visualization of Bands

The gel is treated with luminescent dyes to make the DNA bands visible .and expose to the X _ ray. 

 Applications of RFLP

  • To determine the genetic diseases such as Cystic Fibrosis in an individual.
  • To determine, or confirm the source of a DNA sample such as, in paternity tests or criminal investigations.
  • In genetic mapping to determine recombination rates, that show the genetic distance between the loci.
  • To identify a carrier of a disease causing mutation in the family.

 

Disadvantages

  • RFLP requires a large DNA sample, the isolation of which can require more labor work and time consuming process.

 

 

STR analysis (short tandem repeat in DNA), Amplifying Type DNA Fingerprinting:

  • A Short Tandem Repeat (STR) analysis is one of the very useful methods in molecular biology which is used to compare specific part on DNA from two or more samples.
  • A short tandem repeat is a microsatellite, which consisting of a unit of two to ten nucleotides repeated many times in a row on the DNA strand.STR analysis measures the exact number of repeating units. An individual inherits one copy of an STR from each parent, which may or may not have similar repeat sizes. The number of repeats in STR markers can be highly variable between individuals that makes these STRs effective for human identification purposes.
  • Polymerase chain reaction (PCR) is employed to discover the lengths of the short tandem repeats.
  • Polymerase chain reaction (PCR) is used to make millions of copies of template DNA, similar to molecular photocopying.
  • During PCR, the DNA located between two primers (sense and anti-sense) that flank a region of interest (STR) is amplified, so small amounts of DNA, including from one cell can be analyzed. PCR makes copies of DNA allowing scientists to produce almost any amount to make analyzing the DNA easier.

Forensic DNA scientists usually analyze STRs containing tetra-nucleotide repeats, which can easily be amplified using PCRs.

Method of amplification by a PCR

  1. 1. The sample of DNA is placed in a test tube containing nucleotides as DNA precursors, sense and anti-sense primers flanking the region of interest, and a special type of DNA polymerase (Taq) that can withstand repeated near boiling temperatures.
  2. The tube is placed inside a thermos-cycler which can be repeatedly achieve set temperatures.
  3. The DNA is initially heated to about 94°C (near boiling) to separate the strands into two pieces of single stranded DNA (step-1 in the diagram).
  4. The tube is cooled to about 55°C to allow the primers to bind to the DNA (step-2 in the figure). Then the temperature is raised to about 72°C to allow the Taq polymerase to synthesize new DNA using the original strands as templates beginning at the primer sites (step-3 in the figure).
  5. This process results in duplication of original target DNA (STR) with each of the new molecules containing one old and one new strand of DNA (step-4 in the diagram).
  • STR analysis Occurs when a pattern of TWO or more nucleotides are repeated and the repeated sequences present adjacent to each other.
  • Pattern can range in length from 2 to 10 bp.
  • Typically present in non-coding intron region.

 

  • Currently over 10,000 published STR sequences in human genome.

Amp FLP analysis

 Amp FLP, or amplified fragment length polymorphism was also put into practice during the early 1990s

Procedure

  • In this technique used PCR to amplify DNA samples.  It relied on variable number tandem repeat (VNTR) polymorphisms to distinguish various alleles, which were separated on a polyacrylamide gel using an allelic ladder).
  • Bands could be visualized, by silver stainingthe gel. One popular of this fingerprinting was the D1S80 locus. As with all PCR based methods, highly degraded DNA or very small amounts of DNA may cause allelic dropout or other stochastic effects.
  • In addition, because the analysis is done on a gel, very high number repeats may bunch together at the top of the gel, making it difficult to resolve.
  • Amp FLP analysis can be highly automated, and allows for easy creation of phylogenetictrees based on comparing individual samples of DNA.
  • Due to its relatively low cost and ease of set-up and operation, Amp FLP remains popular in lower income countries.

Advantage

 This method is faster than RFLP analysis.

Disadvantage

Amp FLP analysis can be highly efficient and automated, and allows for easy creation of phylogenetic trees based on comparing individual samples of DNA. Due to its relatively low cost and ease of set-up and operation, Amp FLP remains popular in under developing countries.

.

Y chromosome analysis.

Y chromosome has two parts:  Non-Recombining Portion, PAR – recombine with the X chromosome

  • Third smallest chromosome.
  • More than half of chromosome is heterochromatin contain no genes.
  • Contains many repeats and palindromes.
  • For this reason primers sometimes may bind to more than one region of Y. Contains 90 genes .Majority of genes = Male Specific Region (MSR) – SRY gene determine maleness.

Y chromosome contains same type of variation as autosomes:

STRs,

SNPs

Alu repeats  

 

How we can analyzed the Y chromosome.

The human DNA is segmented into 23 pairs of chromosomes that contain DNA segments and genetic information.

Out of these 23 pairs, 22 pairs are autosomal chromosomes or homologues chromosomes and one pair is the gender chromosome that identifies the gender of the individual. XX identifies a female and XY identifies a male. Thus, the Y chromosome is specific to males.

Example 

 Male 1: GTATGGTGGTGGTGGTGGCTGACGT

Male 2: ATCTGGTGGTGGACTGTACTGCTGAC

Male 1: has TGG repeating STR with frequency of 5

                                        &

Male 2: Has the same repeating STR but with frequency of 3.

These two alleles are observe and differences between them are recorded. The STR profiles are called haplotypes.

.

SNP analysis:

This technique finds that locus on DNA where only a single nucleotide differ on the DNA strand. This method is carried out using PCR technique and gel electrophoresis as that in STR but with a little difference that here only a single nucleotide is considered that exist in polymorphic state SNP markers also recorded on the Y- chromosome. The SNP profiles are called haplogroups.

 Consider the following example,

 Male 1: GTATGTCATGCTGATCGTAGC

Male 2: GTACGTCATGCTGATCGTAGC

 

 

Method

A mixture of the sample is taken from the crime scene and then reference samples   process Extraction and Amplification:  

After the sample is collected, the DNA is observed under microscope to find out the STR markers. From the observation of DNA it can be found that the sample collected belongs to male or female with the help of Amelogenin markers.

Once identifying the gender, the next step involves finding the Y- chromosome STR markers are identified on the Y Chromosomes.

.

PCR Reaction

Amplified the sample DNA   using PCR is enzyme driven amplification process

Gel electrophoresis

DNA is injected into a gel and electric current is applied that separates the different alleles according to their frequency or repeat numbers and then a graph is formed that describes the loci and the amount of DNA on each allele. This peak profile information is unique to each individual and thus can be helpful in finding the identity of the person or matching the culprits

 Identity  . 

Application

Forensic use                                                                              

Sexual Assault          

Paternity Testing                   

Missing    Persons                           

 

Mitochondrial analysis

Although nuclear DNA is more powerful , mtDNA is more stable over time conditions  , mtDNA is present in many copies  mtDNA exists within a double membrane organelle ,Can get more DNA  if sample is limited  Can get DNA from highly degraded source.

 

 

    

 

Mitochondrial DNA  

 

  • Contains 37 genes •
  • Two main regions Non coding region  control’s mtDNA ,
  • Coding region contains 37 genes.
  • Two hypervariable regions Within D-loop HV1 and HV2.
  • Hypervariable Regions D – loop or Control Region • Contains two regions with a lot of variation among different individuals • these regions are amplified with PCR and then sequenced • HV1 – 342 bps • HV2 – 268 bps • Profile is determined by differences in sequence from the CRS (Cambridge Reference Sequence) All other mtDNA is compared to the reference sequence.

Method

 

  • Extraction of DNA from sample
  • Amplification of extracted DNA, to make many exact copies of the DNA we extracted
  • Quantitation of amplified DNA, to determine how much DNA is there.
  • Determine the sequence of two specific regions of the mitochondrial genome
  • Compare the attained sequence of the mitochondrial CODIS Database.
  • How many times does the sequence we have attained appear in the database
  • From that number, we can estimate the frequency of that sequence in the general population

 

Advantages:-

 

  • mitochondrial DNA analysis involves missing person cases
  • It is a valuable technique that can analyses evidence that would otherwise have been rendered useless through another analytical technique.
  • DNA sample may be old and will not have nuclear matter left in the cell. Samples that involve very old bones, teeth or hair shafts are simply not feasible to analyses through techniques such as STR or RFLP analysis , can be analyzed through mitochondrial dna

 Mitochondrial and y chromosome  

  • Autosomal chromosomes recombine with each meiosis
  • Y and Mitochondrial DNA does not recombine.
  • This means that the Y and mtDNA remains constant from generation to generation Except for mutations
  • Therefore Y and mtDNA are known as lineage marker.

              Lineage markers are passed down from generation to generation without changing.

  • They can help determine the lineage (family tree) of an individual
  • Y Chromosome Markers Determine Paternal Lineage
  • Mitochondrial Markers Determine Maternal Lineage

Conclusions

Ø  The arrival of DNA finger printing has revolutionized the concept of identification. It is reasonable to anticipate that DNA fingerprinting is a genetic typing technique applied in a wide variety of contexts. Future advances in DNA technology will reduce the time and cost .Several technique have been developed to deal with the analysis of DNA fingerprints. STR, RFLP, AMP flp Y chromosome, mitochondrial analysis. 

  1. DNA fingerprinting is a genetic typing technique that allows the analysis of the genomic relatedness between samples, and the comparison of DNA patterns. This technique has multiple applications in different fields (medical diagnosis, forensic science, parentage testing, food industry, agriculture and many others)

REFERENCE

 1.Olsvik O, Wahlberg J, Petterson B, Uhlen M, Popovic T, Wachsmuth IK, Fields P(January 1993). “Use of automated sequencing of polymerase chain reaction  generated amplicons to identify three types of cholera toxin subunit B in Vibrio cholera O1 strains”. J. Clin. Mirobiol. 31 (1): 22 -25. PMC 262614. PMID 7678018 .

2.Ehrlich, Melanie; Gama-Sosa, Miguel A; Huang, Lan-Hsiang; Midgett, Rose Marie; Kuo, Kenneth C.; McCune, Roy A; Gehrke, Charles (1982). “Amount and distribution of 5-metylctyosine in human DNA from different types of tissues or cells”. Nucleic acids research . 10 (8): 2709-21. PMID 7079182.

3 Jeffreys AJ, Wilson V, Thein SL(1985).Individual-specific “fingerprints” of Human DNA. Nature , 314:67–74 Lander ES: DNA fingerprinting on trial. Nature 1989, 339:501–505. 7.

4.Balding DJ: Evaluation of mixed-source, low-template DNA profiles in forensic science. Proc Natl Acad Sci U S A 2013, 110:12241–12246.

 5.S.D.Pena., R,Chakrabory.,(2005).DNA  Fingerprinting state of the science: 203_305

6.National Reseach council.,(1992).DNA Technology in Forensic Science.pp 200.

7.National Research council, (1988).Mapping  Research council.pp 128.

8.D.P.Blake.,Beata, cwalina.,(2005). Trends in  DNA  fingerprinting reseach.pp 201.

9.Roew .L (2013)DNA fingerprinting in forensics: past, present, future.journal of investigative genetics 4:  10.1186/2041-2223-4-22

10.Butler M.J  (2015 )The future of forensic DNA  .journal of royal scienc publishing ; 370(1674): 20140252.doi:  10.1098/rstb.2014.0252

  1. https://www.yourgenome.org/facts/
  2. 14. https://academic.oup.com/nar/article/

 15.https://academic.oup.com/nar/article/

16.https://www.yourgenome.org/facts/what-is-a-dna-fingerprint

 17.https://www.nature.com/scitable/topicpage/forensics-dna-fingerprinting.

One thought on “Final DNA Finger Printing

  • May 21, 2020 at 3:28 am
    Permalink

    Great post however , I was wondering if you could write a litte more on this subject? I’d be very grateful if you could elaborate a little bit further. Bless you!

    Reply

Leave a Reply

Your email address will not be published. Required fields are marked *

%d bloggers like this: